Skip to main content

Table 2 Primer sequences obtained from the AutoPrime software (http://www.autoprime.de/AutoPrimeWeb) and validated on BLAST

From: Potentiation of endocannabinoids and other lipid amides prevents hyperalgesia and inflammation in a pre-clinical model of migraine

Gene Forward primer Reverse primer
GAPDH AACCTGCCAAGTATGATGAC GGAGTTGCTGTTGAAGTCA
c-fos TACGCTCCAAGCGGAGAC TTTCCTTCTCTTTCAGTAGATTGG
nNOS CCGGCTACACTTCTCCTCAC CACGAAGCAGGGGACTACAT
CGRP CAGTCTCAGCTCCAAGTCATC TTCCAAGGTTGACCTCAAAG
SP GCTCTTTATGGGCATGGTC GGGTTTATTTACGCCTTCTTTC
IL-1beta CTTCCTTGTGCAAGTGTCTG CAGGTCATTCTCCTCACTGTC
IL-6 TTCTCTCCGCAAGAGACTTC GGTCTGTTGTGGGTGGTATC
TNF-alpha CCTCACACTCAGATCATCTTCTC CGCTTGGTGGTTTGCTAC