Skip to main content

Table 1 Sequence for shRNA and real-time PCR primers

From: Neuropeptide FF receptor 2 inhibits capsaicin-induced CGRP Upregulation in mouse trigeminal ganglion

Name ID Sequence
Npffr2-a shRNA TRCN0000027462 GCCTATCACATTGCTGGACAA
Npffr2-b shRNA TRCN0000027446 GCGTATCATCAACATCTACAT
Npffr2-c shRNA TRCN0000027471 GCGAAACGCAACATAGTCATA
Npffr2-d shRNA TRCN0000027453 CCATCTGCAATAATGTTACAT
Npffr2-e shRNA TRCN0000027484 GCATCACTGGTATTCAGATAT
Control shRNA TRCN0000072232 CGTCGTATTACAACGTCGTGA
Rpl35a-forward   GCTGTGGTCCAAGGCCATTTT
Rpl35a-reverse   CCGAGTTACTTTTCCCCAGATGAC
Npffr2-forward   ACATCTACCCTTTCGCCCAC
Npffr2-reverse   GCTTCTCCCATTTCCTCTATCAA