Skip to main content

Table 1 Primers used for RT-PCR analysis

From: Electrical stimulation of the superior sagittal sinus suppresses A-type K+ currents and increases P/Q- and T-type Ca2+ currents in rat trigeminal ganglion neurons

Gene Accession number
Primer sequences
Kv4.1 NM_001105748.1 sense: 5′- AGAGTATAGGGACCGCAAGA −3′
anti-sense: 5′- AATGTAGTAGGGCAGGATGG − 3’
Kv4.2 NM_031730.2 sense: 5’- CGGGTTCTTCATTGCCGTCTC − 3′
anti-sense: 5‘- TTCGTTTGTCCGCTCGTTGG − 3’
Kv4.3 NM_001270962.1 sense: 5′- GCCTCACTCAAGGTTTCACA − 3′
anti-sense: 5′- CTGTTCCTCTTATGGTGGTTA − 3’
Kv1.4 NM_012971.2 sense: 5’- GCAGTCAGTTGCCCATACCT − 3′
anti-sense: 5‘- TCTCCTCGGGACCACCTTTA − 3’
Kv3.4 NM_001122776.1 sense: 5′- TTGACCGAAATGTGACGGAGAT − 3′