Skip to main content

Table 1 PCR and SNaPshot Probe Primer Sequences

From: Case-control study of GRIA1 and GRIA3 gene variants in migraine

Polymorphisms Primers Product size Sequence 5′ → 3′
GRIA1 Forward 297bp CACCCCAAGTTTTCACTGCT
rs548294 Reverse 297bp GAACCTAAAAGATCCCCAGGT
  Probe 63bp 37Ts+CTTAACTCTTAGGCTCTAATA
GRIA1 Forward 259bp GCTGGAGGAGTCCAGAACAG
rs2195450 Reverse 259bp TGCTTGGTAGATGGTGCTTG
  Probe 70bp 45Ts+CCCCTCACTCCTTCTTCT
GRIA3 Forward 373bp TGCCAGTGTAAAGCGAACTG
rs3761555 Reverse 373bp GGGGATGACCAACCTTACCT
  Probe 56bp 35Ts+TTCAAAATGGAGACAAAAGAT